PCR

Reagents:

700 µM Down blocking mix: D1 = JB3324; D2 = JB3326
700 µM Up blocking Mix: U1 = JB3323; U2 = JB3325

Primer Sequences
JB3348 = 5’ - Cy3 GGATACACTGACCAGCTACGATGAT
JB3391 = 5’ - Cy5 GGATACACTGACCAGCTACGATGAT

Preparation of 1 X SSTE

	To make 500 ml
1 M NaCl	100 ml 5 M NaCl
10 mM Tris, pH 7.5	5 ml 1M Tris.Cl, pH 7.5
0.5% Triton X-100	2.5 ml Triton X-100

Preparation of 20x SSPE

	1 Liter	500 ml	FW
NaCl	175.3 g	87.65 g	58.44 g
Na H2 PO4 (monobasic)	27.6 g	13.8 g	119.9g
EDTA	7.4 g	3.7 g	372.24g
AdjustpH to 7.4 with 10N NaOH	~6.5 ml	3.25 ml

Preparation of 6 X SSPE + 0.05% Triton-X

	50 ml	500 ml
100% triton	25µl	250µl
20X SSPE	15 ml	150 ml
water	35 ml	350ml

1) Prepare plastic bag (Kapak Corporation, Cat #: 500). The dimension of the bag should be ~4.5 cm x 12 cm.
2) Place chip in plastic bag.

3) Prewarm 3.5 ml of 1 x SSTE for each reaction at 40遨 in a 50 ml conical tube.
4) Add 3.5 µl (each) of 5 nM control gridline primer Cy3-JB3348 and Cy5-JB3391 to 3.5 ml of hybridization buffer.
5) Add 5 µl of 700 µM down OR up blocking primers to 3.5 ml of hybridization buffer. The hybridization solution containing gridline primers and blocking primers could be prepared as a master mix that is then aliquoted into different tubes.

PCR probe preparation

6) Incubate 70 µl (each) of Cy3 and Cy5 PCR products in separate eppendorf tubes at 100遨 for 1 minute.
7) Set on ice. Perform a quick spin to collect all PCR products.
8) Add the denatured PCR products to the hybridization buffer.
9) Mix well.
10) Pipet the entire hybridization buffer containing probes into the plastic bag containing chip.
11) Seal the top of the plastic bag, avoid forming air bubbles by pushing the air bubbles out of the bag. Wrap the sealed bag in aluminum foil to minimize light exposure.
12) Hybridize at 42遨 for 2 to 5 hours.
13) Hybridization reaction should contain:

	Volume;	Final [ ];
1 X SSTE;	3.5 ml
700 µM (ea) Up or Down Mix	7.0 µl	1.3 µM
5 nM Cy3 (JB 3348) gridline primer	3.5 µl	5 pM final
5 nM Cy5 (JB 3391) gridline primer	3.5µl	5 pM final
Cy3 & Cy5 PCR product	140 µl

14) Wash chips in 6 X SSPE (0.9 M NaCl, 60 mM NaH2PO4, 6 mM EDTA) + 0.05% Triton-X. The chip is washed by dipping it into 50 ml of 6 X SSPE + 0.05% Triton X-100 in a 50 ml conical tube three to five times. “Dipping” means immersing the chip fully into the solution using a forcep that holds the chip from the top, and then slowly remove it from the solution. One dip takes about 2 seconds.
15) Wash chips in 1 X SSPE three to five times.
16) Slowly remove the chips from 0.06X SSPE. During the last dip in 1 X SSPE, pull the chip out SLOWLY from the solution. As the chip is being pulled out, one sees that all the water leaves the surface of the chip and the DNA grid imprinted on the chip is visible.
17) Scan chips.
18) Store chips at –20遨, strip immediately or on the next day.