Last updated:December 2, 2003 by Siew-Loon Ooi
Primer Sequences
JB3348 = 5’ - Cy3 GGATACACTGACCAGCTACGATGAT
JB3391 = 5’ - Cy5 GGATACACTGACCAGCTACGATGAT
| To make 500 ml | |
| 1 M NaCl | 100 ml 5 M NaCl |
| 10 mM Tris, pH 7.5 | 5 ml 1M Tris.Cl, pH 7.5 |
| 0.5% Triton X-100 | 2.5 ml Triton X-100 |
| 1 Liter | 500 ml | FW | |
| NaCl | 175.3 g | 87.65 g | 58.44 g |
| Na H2 PO4 (monobasic) | 27.6 g | 13.8 g | 119.9g |
| EDTA | 7.4 g | 3.7 g | 372.24g |
| AdjustpH to 7.4 with 10N NaOH | ~6.5 ml | 3.25 ml |
| 50 ml | 500 ml | |
| 100% triton | 25µl | 250µl |
| 20X SSPE | 15 ml | 150 ml |
| water | 35 ml | 350ml |
Protocol:
1) Prepare plastic bag (Kapak Corporation, Cat #: 500). The dimension
of the bag should be ~4.5 cm x 12 cm.
2) Place chip in plastic bag.
Hybridization solution preparation
3) Prewarm 3.5 ml of 1 x SSTE for each reaction at 40¾C in a 50
ml conical tube.
4) Add 3.5 µl (each) of 5 nM control gridline primer Cy3-JB3348 and Cy5-JB3391
to 3.5 ml of hybridization buffer.
5) Add 5 µl of 700 µM down OR up blocking primers to 3.5 ml of
hybridization buffer. The hybridization solution containing gridline primers
and blocking primers could be prepared as a master mix that is then aliquoted
into different tubes.
******************************************************************
PCR probe preparation
6) Incubate 70 µl (each) of Cy3 and Cy5 PCR products
in separate eppendorf tubes at 100¾C for 1 minute.
7) Set on ice. Perform a quick spin to collect all PCR
products.
8) Add the denatured PCR products to the hybridization buffer.
9) Mix well.
10) Pipet the entire hybridization buffer containing probes into the plastic
bag containing chip.
11) Seal the top of the plastic bag, avoid forming air bubbles by pushing
the air bubbles out of the bag. Wrap the sealed bag in aluminum foil to minimize
light exposure.
12) Hybridize at 42¾C for 2 to 5 hours.
13) Hybridization reaction should contain:
| Volume; | Final [ ]; | |
| 1 X SSTE; | 3.5 ml | |
| 700 µM (ea) Up or Down Mix | 7.0 µl | 1.3 µM |
| 5 nM Cy3 (JB 3348) gridline primer | 3.5 µl | 5 pM final |
| 5 nM Cy5 (JB 3391) gridline primer | 3.5µl | 5 pM final |
| Cy3 & Cy5 PCR product | 140 µl |